The biomers.net bulk import function can read Excel files in all formats used from Excel 97 onwards both from the Windows and Macintosh versions of Excel up to Excel 2010 and Excel 2008 for the Macintosh (file extensions .xls and .xlsx).
The oligonucleotide data must be formatted as follows:
- No header row. The oligo data has to start in row 1.
- For each oligo there has to be an oligo name in column A and the oligo's sequence in column B. Any additional data in other columns will be ignored by the import function, but will not interfere with the import process in any way and does not need to be removed before importing the data.
- As the import function regards the first empty line it encounters as the end of the data to import, the oligonucleotide data must not contain empty rows followed by data that is supposed to be imported.
Files in the so-called CSV format are ordinary text files that contain data in a certain format: Each line contains one oligonucleotide. Oligo name and sequence are separated by a semicolon (;) or a TAB. Blanks and empty lines will be removed on import. Should your input data have an incorrect number of separators or should your DNA sequences contain illegal characters, the system will warn you on import and you will have a chance to correct the problem.
Below an example of the required input data:
Oligo 1;agtgtgtatgctagctagtgtgtagctagctgatcgatgctagctagct
Oligo 2;tggtacgtagctagcgatgctagctagctgatcgatgctagctagtcgatgc
...
Oligo n;tgtagcgatgtagctagtcgatcgtagctagtcagtgtagctgt
You can also paste CSV-formatted data in the text box below instead of importing it from a file or you can cut-and-paste the oligonucleotide data from an Excel sheet. Excel will automatically insert TAB characters as column separators in this case.
CSV-formatted files can be exported by many programs. E.g. you can easily create a csv file you can import without further editing if you save an Excel worksheet using the CSV format that does only contain the oligos' names in the first and the oligos' sequences in the second column. Please mind: The import only supports characters that are part of the ASCII character set. Symbols and special characters (e.g. greek letters) are either replaced on import with respective letters and ASCII special characters or are dropped entirely. You should remove all non-ASCII characters before importing. Case of oligonames is preserved. All sequence characters are converted to lower case.
Please do not use any brackets or other special characters in oligoname or sequence.